| Detail of EST/Unigene TCMT49273 |
| Acc. | TCMT49273 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytosolic 5'-nucleotidase III-like protein OS=Gallus gallus E-value=2e-18; Cytosolic 5'-nucleotidase III-like protein A OS=Xenopus laevis E-value=1e-16; Cytosolic 5'-nucleotidase 3 OS=Danio rerio E-value=2e-16; Cytosolic 5'-nucleotidase III-like protein B OS=Xenopus laevis E-value=2e-16; Cytosolic 5'-nucleotidase III OS=Gallus gallus E-value=2e-16; |
| Length | 630 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_DSTEM2 (1 ESTs); MT_NOD_GVSN (1 ESTs); |
| Sequence | TGTAATTCATGCAGAGGCTGATGAGACATATGAATCACATTTTCTTAATTAGTTTTGTTA |
| EST members of Unigene | AW695236 BE999401 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01081 5'-nucleotidase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01081 5'-nucleotidase; Metabolism > Metabolism of Cofactors and Vitamins > ko00760 Nicotinate and nicotinamide metabolism > K01081 5'-nucleotidase |
| EC | 3.1.3.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.13614.1.S1_at
|
| Corresponding NCBI Gene | 818450 |
| Trichome-related Gene from Literature | N/A |