Detail of EST/Unigene TCMT49857 |
Acc. | TCMT49857 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, mitochondrial OS=Arabidopsis thaliana E-value=2e-67; Serine hydroxymethyltransferase, mitochondrial OS=Solanum tuberosum E-value=2e-66; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=2e-66; Serine hydroxymethyltransferase, cytosolic OS=Mus musculus E-value=1e-65; Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=1e-65; |
Length | 915 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (3 ESTs); MT_JAS_ROOR (3 ESTs); MT_DSTEM2 (2 ESTs); MT_ECELL (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_HOGA (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
Sequence | TCTTCATTCTACGCTCTCTCTCAGTAAACCACGTTGTGTCATTGTCTACTCTCCGCGCCG |
EST members of Unigene | AW689889 AW689463 BF650659 CB892119 BI264893 BI264376 BG456756 CX534901 CX533724 CX533086 CB894373 BI265100 EY475951 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1105.1.S1_at, Mtr.37725.1.S1_at
|
Corresponding NCBI Gene | 829387 |
Trichome-related Gene from Literature | N/A |