Detail of EST/Unigene TCMT49947 |
Acc. | TCMT49947 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 71D1 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 71C3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 71C4 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 71D2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 71C2 OS=Arabidopsis thaliana E-value=0; |
Length | 1726 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT (7 ESTs); MT_DFLOWER (2 ESTs); MT_ECELL (1 ESTs); MTAMP (1 ESTs); MT_LEAF_PHOMA (1 ESTs); MtBA (1 ESTs); MT_CDS (1 ESTs); MT_DSTEM2 (1 ESTs); |
Sequence | GCTGCAGGAATTCGGCACGAGGGAAAGAACAAAGAAAATGTCTATGAGTGATATAAACAA |
EST members of Unigene | AY747627 AW690200 BG448040 AJ504366 BQ147610 BI271442 BQ139582 AL367750 BI265799 BE322359 BE321636 BE322549 BF641773 BF640469 BF639412 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.45 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.43655.1.S1_at, Mtr.45291.1.S1_at
|
Corresponding NCBI Gene | 817523 |
Trichome-related Gene from Literature | N/A |