Detail of EST/Unigene TCMT50996 |
Acc. | TCMT50996 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glucuronoxylan glucuronosyltransferase IRX7 OS=Arabidopsis thaliana E-value=6e-60; Probable glucuronoxylan glucuronosyltransferase F8H OS=Arabidopsis thaliana E-value=4e-55; Probable glucuronosyltransferase Os03g0107900 OS=Oryza sativa subsp. japonica E-value=6e-51; Probable glucuronosyltransferase Os01g0926400 OS=Oryza sativa subsp. japonica E-value=8e-32; Probable beta-1,4-xylosyltransferase IRX10 OS=Arabidopsis thaliana E-value=9e-31; |
Length | 923 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SEEDROOT_KV3 (3 ESTs); MT_DSIL (1 ESTs); MT_MGHG (1 ESTs); |
Sequence | CACCCACAATTCTTATTTTTTTTATCGATCCAAAATATAACATCAAAGCATATGATTTCA |
EST members of Unigene | CB891722 BG646041 BG644833 BF519250 BE943509 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2 |
EC | 2.4.1.224 2.4.1.225 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40320.1.S1_at
|
Corresponding NCBI Gene | 817357 |
Trichome-related Gene from Literature | N/A |