| Detail of EST/Unigene TCMT50996 |
| Acc. | TCMT50996 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glucuronoxylan glucuronosyltransferase IRX7 OS=Arabidopsis thaliana E-value=6e-60; Probable glucuronoxylan glucuronosyltransferase F8H OS=Arabidopsis thaliana E-value=4e-55; Probable glucuronosyltransferase Os03g0107900 OS=Oryza sativa subsp. japonica E-value=6e-51; Probable glucuronosyltransferase Os01g0926400 OS=Oryza sativa subsp. japonica E-value=8e-32; Probable beta-1,4-xylosyltransferase IRX10 OS=Arabidopsis thaliana E-value=9e-31; |
| Length | 923 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SEEDROOT_KV3 (3 ESTs); MT_DSIL (1 ESTs); MT_MGHG (1 ESTs); |
| Sequence | CACCCACAATTCTTATTTTTTTTATCGATCCAAAATATAACATCAAAGCATATGATTTCA |
| EST members of Unigene | CB891722 BG646041 BG644833 BF519250 BE943509 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02366 glucuronyl/N-acetylglucosaminyl transferase EXT1; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2 |
| EC | 2.4.1.224 2.4.1.225 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.40320.1.S1_at
|
| Corresponding NCBI Gene | 817357 |
| Trichome-related Gene from Literature | N/A |