| Detail of EST/Unigene TCMT51584 |
| Acc. | TCMT51584 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=3e-57; Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=4e-56; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=3e-38; Cytochrome P450 77A2 OS=Solanum melongena E-value=5e-35; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=9e-33; |
| Length | 758 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_SIRRA (1 ESTs); MT_INSECT (1 ESTs); MT_JCVI-MT3 (1 ESTs); |
| Sequence | CATAAACTTCGGTATTTGAAGTGCGTGGTTTTGGAAGGGTTGAGGCGTCATCCACCAGGG |
| EST members of Unigene | BQ156089 BF639210 EY477935 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.51065.1.S1_at
|
| Corresponding NCBI Gene | 842803 |
| Trichome-related Gene from Literature | N/A |