Detail of EST/Unigene TCMT52403 |
Acc. | TCMT52403 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D11 (Fragment) OS=Lotus japonicus E-value=2e-66; Cytochrome P450 71D9 OS=Glycine max E-value=8e-66; Cytochrome P450 71D10 OS=Glycine max E-value=3e-59; Cytochrome P450 71D8 OS=Glycine max E-value=4e-59; Tabersonine 16-hydroxylase (Fragment) OS=Catharanthus roseus E-value=7e-59; |
Length | 729 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_KVKC (1 ESTs); |
Sequence | CAATAACTTAACATTACAAAACGTTACTCGAGAATAGCATAGCCCATTAACTTTATTATC |
EST members of Unigene | CA921518 BQ165215 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00361 gamma-Hexachlorocyclohexane degradation > K07424 cytochrome P450, family 3, subfamily A; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41475.1.S1_at
|
Corresponding NCBI Gene | 822234 |
Trichome-related Gene from Literature | N/A |