| Detail of EST/Unigene TCMT53440 |
| Acc. | TCMT53440 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=2e-54; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=8e-54; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-53; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-53; Probable glutathione S-transferase OS=Glycine max E-value=3e-53; |
| Length | 967 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (4 ESTs); MtBC_GLOMUS (2 ESTs); MTAMP (2 ESTs); MT_Drought (1 ESTs); |
| Sequence | CTCCAATATAAATTTGCTTATGTGACACTCAATATCATATATTTCACTTCCTTATTTACA |
| EST members of Unigene | AL386308 AL386307 BF650674 BF650466 BF648974 BF646348 AJ503981 AJ502854 BF633357 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.38111.1.S1_at
|
| Corresponding NCBI Gene | 817491 |
| Trichome-related Gene from Literature | N/A |