Detail of EST/Unigene TCMT53636 |
Acc. | TCMT53636 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=0; Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=1e-98; Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=4e-90; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=3e-87; Beta-glucosidase 16 OS=Oryza sativa subsp. japonica E-value=1e-83; |
Length | 951 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JCVI-MT1 (1 ESTs); MT_CDS (1 ESTs); |
Sequence | GGCAAATTTGGAAATTGTAGCGAGGGCGATTCCGAGAAGGATCCCTTTGTAGCAGCCCAT |
EST members of Unigene | BT051115 EV256205 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41977.1.S1_at
|
Corresponding NCBI Gene | 842479 |
Trichome-related Gene from Literature | N/A |