| Detail of EST/Unigene TCMT53843 |
| Acc. | TCMT53843 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Choline/ethanolamine kinase OS=Rattus norvegicus E-value=1e-42; Choline/ethanolamine kinase OS=Mus musculus E-value=1e-42; Choline/ethanolamine kinase OS=Homo sapiens E-value=2e-42; Ethanolamine kinase 2 OS=Mus musculus E-value=6e-42; Choline kinase alpha OS=Mus musculus E-value=1e-41; |
| Length | 1285 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL (2 ESTs); MT_CDS (1 ESTs); MT_DSTEM2 (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_ROOTPHOS (1 ESTs); |
| Sequence | GCCAAACAATCAACACTTCTTGCTCTCTCTCTCCTCTACTACTTCTTTGTGGTTTCTGTT |
| EST members of Unigene | BT051815 AW692944 BF648778 BF648603 EV256418 AW287959 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00866 choline kinase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00866 choline kinase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00894 ethanolamine kinase |
| EC | 2.7.1.32 2.7.1.82 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.32085.1.S1_at
|
| Corresponding NCBI Gene | 843772 |
| Trichome-related Gene from Literature | N/A |