Detail of EST/Unigene TCMT54089 |
Acc. | TCMT54089 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=0; Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=0; Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=0; UDP-glycosyltransferase 84A2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=0; |
Length | 1391 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS (1 ESTs); MT_ECELL (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_GPOD (1 ESTs); |
Sequence | GAAAAACAAAAATGGCATCCGAAGCTTCAATTCACATCCTCCTTGTTTCTTTTCCAGCAC |
EST members of Unigene | DQ875462 BF644451 EV260704 BI308322 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.10121.1.S1_at, Mtr.5692.1.S1_at
|
Corresponding NCBI Gene | 821710 |
Trichome-related Gene from Literature | 821710 |