Detail of EST/Unigene TCMT54176 |
Acc. | TCMT54176 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Ribonucleoside-diphosphate reductase small chain OS=Spisula solidissima E-value=0; Ribonucleoside-diphosphate reductase subunit M2 OS=Danio rerio E-value=0; Ribonucleoside-diphosphate reductase subunit M2 OS=Rattus norvegicus E-value=0; Ribonucleoside-diphosphate reductase subunit M2 OS=Mesocricetus auratus E-value=0; Ribonucleoside-diphosphate reductase subunit M2 OS=Homo sapiens E-value=0; |
Length | 1482 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_CDS (1 ESTs); MT_JCVI-MT1 (1 ESTs); MT_NOD_ROOT (1 ESTs); MT_PhoLEAF (1 ESTs); |
Sequence | GATCCAACATCTCTCTTTGGTAACAAGCAACTTGTACCTCTCTGTTTCGGATAACAGAGT |
EST members of Unigene | BT051679 EV255470 AW684593 BG456974 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K10808 ribonucleoside-diphosphate reductase subunit M2 |
EC | 1.17.4.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Msa.1441.1.S1_at, Mtr.45570.1.S1_at
|
Corresponding NCBI Gene | 821937 |
Trichome-related Gene from Literature | N/A |