| Detail of EST/Unigene TCMT54539 |
| Acc. | TCMT54539 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable carotenoid cleavage dioxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=9e-72; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=7e-53; 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=2e-30; 9-cis-epoxycarotenoid dioxygenase NCED9, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=8e-30; |
| Length | 680 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_VILEAF (1 ESTs); |
| Sequence | GGAAGATGATGAGGAAACTGTGACACTAATTGCTCCAAATGTTCTCTCCATTGAGCATAC |
| EST members of Unigene | CA919577 CX521092 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.99.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.46164.1.S1_s_at
|
| Corresponding NCBI Gene | 827655 |
| Trichome-related Gene from Literature | N/A |