Detail of EST/Unigene TCMT54539 |
Acc. | TCMT54539 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable carotenoid cleavage dioxygenase 4, chloroplastic OS=Arabidopsis thaliana E-value=9e-72; Zeaxanthin 7,8(7',8')-cleavage dioxygenase, chromoplast OS=Crocus sativus E-value=7e-53; 9-cis-epoxycarotenoid dioxygenase NCED3, chloroplastic OS=Arabidopsis thaliana E-value=2e-30; 9-cis-epoxycarotenoid dioxygenase NCED9, chloroplastic OS=Arabidopsis thaliana E-value=3e-30; Carotenoid 9,10(9',10')-cleavage dioxygenase 1 OS=Arabidopsis thaliana E-value=8e-30; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MT_VILEAF (1 ESTs); |
Sequence | GGAAGATGATGAGGAAACTGTGACACTAATTGCTCCAAATGTTCTCTCCATTGAGCATAC |
EST members of Unigene | CA919577 CX521092 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.14.99.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.46164.1.S1_s_at
|
Corresponding NCBI Gene | 827655 |
Trichome-related Gene from Literature | N/A |