Detail of EST/Unigene TCMT54594 |
Acc. | TCMT54594 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 73B4 OS=Arabidopsis thaliana E-value=2e-46; UDP-glucose flavonoid 3-O-glucosyltransferase 7 OS=Fragaria ananassa E-value=1e-44; UDP-glycosyltransferase 73B5 OS=Arabidopsis thaliana E-value=3e-44; UDP-glucosyl transferase 73B2 OS=Arabidopsis thaliana E-value=5e-44; UDP-glycosyltransferase 73B3 OS=Arabidopsis thaliana E-value=7e-42; |
Length | 847 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBC_GLOMUS (2 ESTs); MTUS_MIXTISSUE (1 ESTs); |
Sequence | AGCTTCTGAGTTTCCATTCATTTGGGTGTGAGGAAAAGTGCTAAAAGTGAAGGTGAAAAT |
EST members of Unigene | CA921728 AL387225 AL387224 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.45 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.16941.1.S1_at
|
Corresponding NCBI Gene | 816041 |
Trichome-related Gene from Literature | N/A |