| Detail of EST/Unigene TCMT54664 |
| Acc. | TCMT54664 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=0; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=4e-82; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=1e-64; Cullin-2 OS=Arabidopsis thaliana E-value=1e-41; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=3e-38; |
| Length | 822 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_IROOT_DSIR (1 ESTs); MT_JAS_ROOR (1 ESTs); MT_Drought (1 ESTs); |
| Sequence | CGAGTCCATAGCTTCATCGATAGTCTCTTTCTTCATCGCTCTGCTAGGCAACAATGGCAC |
| EST members of Unigene | AW561087 CX531263 BF632359 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03347 cullin 1; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.42092.1.S1_at
|
| Corresponding NCBI Gene | 825648 |
| Trichome-related Gene from Literature | N/A |