| Detail of EST/Unigene TCMT55423 |
| Acc. | TCMT55423 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=3e-72; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=2e-65; Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=1e-64; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=2e-58; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=7e-56; |
| Length | 678 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ROOTPHOS (1 ESTs); MHRP-root (1 ESTs); |
| Sequence | GGTACTATTGTGTTACCTTCACAAGAACAAGTGAATGAAATTGCACATGGGTTATTGGAT |
| EST members of Unigene | AW329251 BG588616 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
| EC | 2.4.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.21701.1.S1_s_at, Mtr.39358.1.S1_at
|
| Corresponding NCBI Gene | 827220 |
| Trichome-related Gene from Literature | 827220 |