Detail of EST/Unigene TCMT55423 |
Acc. | TCMT55423 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Putative UDP-glucose glucosyltransferase OS=Fragaria ananassa E-value=3e-72; Limonoid UDP-glucosyltransferase OS=Citrus unshiu E-value=2e-65; Cinnamate beta-D-glucosyltransferase OS=Fragaria ananassa E-value=1e-64; UDP-glycosyltransferase 84A1 OS=Arabidopsis thaliana E-value=2e-58; UDP-glycosyltransferase 84A4 OS=Arabidopsis thaliana E-value=7e-56; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ROOTPHOS (1 ESTs); MHRP-root (1 ESTs); |
Sequence | GGTACTATTGTGTTACCTTCACAAGAACAAGTGAATGAAATTGCACATGGGTTATTGGAT |
EST members of Unigene | AW329251 BG588616 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.21701.1.S1_s_at, Mtr.39358.1.S1_at
|
Corresponding NCBI Gene | 827220 |
Trichome-related Gene from Literature | 827220 |