Detail of EST/Unigene TCMT55427 |
Acc. | TCMT55427 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Uridine 5'-monophosphate synthase OS=Arabidopsis thaliana E-value=3e-40; Uridine 5'-monophosphate synthase (Fragment) OS=Nicotiana tabacum E-value=1e-39; Uridine 5'-monophosphate synthase OS=Bos taurus E-value=2e-29; Uridine 5'-monophosphate synthase OS=Pongo abelii E-value=1e-27; Uridine 5'-monophosphate synthase OS=Drosophila melanogaster E-value=2e-27; |
Length | 440 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtBA (2 ESTs); |
Sequence | TGAAAACTGCGTTAAAGTGGAAGATAATGGATTCCTTGAAACATATGCAGCAGCGGCAAT |
EST members of Unigene | AL368276 AL368206 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00762 orotate phosphoribosyltransferase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01591 orotidine-5'-phosphate decarboxylase |
EC | 2.4.2.10 4.1.1.23 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.13792.1.S1_at, Mtr.13792.1.S1_s_at
|
Corresponding NCBI Gene | 824612 |
Trichome-related Gene from Literature | N/A |