Detail of EST/Unigene TCMT56008 |
Acc. | TCMT56008 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A2 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=0; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=0; |
Length | 1349 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (4 ESTs); MT_INSECT (2 ESTs); MT_JCVI-MT2 (2 ESTs); MHRP-root (1 ESTs); MT_DFLOWER (1 ESTs); MT_BML (1 ESTs); |
Sequence | CTAAAATGGACCAAAAGCCTCATGTTGTATTAGTACCATTTCCAGCACAAGGTCATGTGA |
EST members of Unigene | AW697384 BE325595 AW694329 AW691690 BE239374 BI271721 BI267338 BF641059 GE352377 GE348053 GD185391 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase |
EC | 2.4.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.40385.1.S1_at
|
Corresponding NCBI Gene | 838844 |
Trichome-related Gene from Literature | N/A |