Detail of EST/Unigene TCMT57297 |
Acc. | TCMT57297 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxisomal acyl-coenzyme A oxidase 1 OS=Arabidopsis thaliana E-value=0; Putative peroxisomal acyl-coenzyme A oxidase 1.2 OS=Arabidopsis thaliana E-value=0; Peroxisomal acyl-coenzyme A oxidase 1 OS=Phascolarctos cinereus E-value=2e-47; Peroxisomal acyl-coenzyme A oxidase 1 OS=Cavia porcellus E-value=2e-46; Peroxisomal acyl-coenzyme A oxidase 1 OS=Rattus norvegicus E-value=3e-46; |
Length | 866 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL (1 ESTs); MT_SEEDROOT_KV3 (1 ESTs); MT_SROOT_KV2 (1 ESTs); MT_HOGA (1 ESTs); |
Sequence | GATACTCCACAAATAATGAATTAAATTTGGACCAAAGTTTGAAAAGAAAAAATCAAACGT |
EST members of Unigene | BG448110 AW736024 AW299202 BG648624 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
EC | 1.3.3.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.41848.1.S1_at
|
Corresponding NCBI Gene | 827381 |
Trichome-related Gene from Literature | N/A |