| Detail of EST/Unigene TCMT57597 |
| Acc. | TCMT57597 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 5, peroxisomal OS=Arabidopsis thaliana E-value=4e-40; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=2e-38; Probable acyl-activating enzyme 8 OS=Arabidopsis thaliana E-value=2e-37; Probable acyl-activating enzyme 9 OS=Arabidopsis thaliana E-value=2e-33; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=2e-32; |
| Length | 609 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT (1 ESTs); MtBA (1 ESTs); MT_MGHG (1 ESTs); |
| Sequence | GTGATTATTAGTGGTGGTGAGAATTTGAGTAGTGTGGAGGTTGAGTCGGTTTTGTATGGA |
| EST members of Unigene | AW686379 AL370691 BE941629 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
| EC | 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.41772.1.S1_at
|
| Corresponding NCBI Gene | 831498 |
| Trichome-related Gene from Literature | N/A |