| Detail of EST/Unigene TCMT57623 |
| Acc. | TCMT57623 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | 1-aminocyclopropane-1-carboxylate synthase 1 OS=Prunus mume E-value=2e-83; 1-aminocyclopropane-1-carboxylate synthase 2 OS=Solanum lycopersicum E-value=5e-80; 1-aminocyclopropane-1-carboxylate synthase OS=Nicotiana tabacum E-value=2e-79; 1-aminocyclopropane-1-carboxylate synthase OS=Glycine max E-value=1e-77; 1-aminocyclopropane-1-carboxylate synthase (Fragment) OS=Vigna radiata var. radiata E-value=4e-77; |
| Length | 969 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_HOGA (3 ESTs); |
| Sequence | AATAAGAATCACCAACTTTTGTCAAAGATTGCTACCAACGATAAACATGGTGAAAATTCT |
| EST members of Unigene | CB894091 CB894005 CB893855 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K00814 alanine transaminase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00814 alanine transaminase |
| EC | 2.6.1.2 4.4.1.14 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.9788.1.S1_at
|
| Corresponding NCBI Gene | 837082 |
| Trichome-related Gene from Literature | N/A |