Detail of EST/Unigene TCMT58081 |
Acc. | TCMT58081 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S14, chloroplastic OS=Cicer arietinum E-value=4e-28; 30S ribosomal protein S14, chloroplastic OS=Lotus japonicus E-value=2e-27; 30S ribosomal protein S14, chloroplastic OS=Lobularia maritima E-value=3e-27; 30S ribosomal protein S14, chloroplastic OS=Glycine max E-value=2e-26; 30S ribosomal protein S14, chloroplastic OS=Solanum tuberosum E-value=2e-26; |
Length | 195 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_PhoLEAF (2 ESTs); |
Sequence | CGTTAAGTGAGAAATGGGAAATTCAGGGAAAGTTAGAAGCACTACCGCGTAATAGTGCAC |
EST members of Unigene | BG458146 BG455527 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45633.1.S1_s_at
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |