Detail of EST/Unigene TCMT58137 |
Acc. | TCMT58137 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glucuronate 4-epimerase 5 OS=Arabidopsis thaliana E-value=4e-84; UDP-glucuronate 4-epimerase 2 OS=Arabidopsis thaliana E-value=3e-83; UDP-glucuronate 4-epimerase 4 OS=Arabidopsis thaliana E-value=1e-82; UDP-glucuronate 4-epimerase 3 OS=Arabidopsis thaliana E-value=2e-82; UDP-glucuronate 4-epimerase 1 OS=Arabidopsis thaliana E-value=2e-78; |
Length | 867 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT (1 ESTs); MT_JCVI-MT2 (1 ESTs); |
Sequence | ATAGATAGATAGTCAACATAAGTCAAAACCCTCGAAATCAACAAACAAGAACGAACACCG |
EST members of Unigene | AW684965 GE344918 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01784 UDP-glucose 4-epimerase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01784 UDP-glucose 4-epimerase |
EC | 4.2.1.46 5.1.3.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.5062.1.S1_at
|
Corresponding NCBI Gene | 826833 |
Trichome-related Gene from Literature | N/A |