Detail of EST/Unigene TCMT58350 |
Acc. | TCMT58350 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase large chain OS=Nostoc sp. (strain PCC 7120 / UTEX 2576) E-value=1e-62; Carbamoyl-phosphate synthase large chain OS=Synechocystis sp. (strain PCC 6803 / Kazusa) E-value=3e-59; Carbamoyl-phosphate synthase large chain OS=Gemmatimonas aurantiaca (strain T-27 / DSM 14586 / JCM 11422 / NBRC 100505) E-value=2e-46; Carbamoyl-phosphate synthase large chain OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=2e-46; Carbamoyl-phosphate synthase large chain OS=Buchnera aphidicola subsp. Acyrthosiphon pisum (strain APS) E-value=5e-44; |
Length | 643 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2 (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | CTTCTGCTCTTGCTAGTAAGGCTACTGGGTTTCCAATAGCAGAAGATGGCGTGCAAAGTT |
EST members of Unigene | AW695953 BI267910 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01948 carbamoyl-phosphate synthase (ammonia); Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01948 carbamoyl-phosphate synthase (ammonia) |
EC | 6.3.4.16 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.45536.1.S1_at
|
Corresponding NCBI Gene | 839868 |
Trichome-related Gene from Literature | N/A |