Detail of EST/Unigene TCMT59002 |
Acc. | TCMT59002 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 45 OS=Arabidopsis thaliana E-value=7e-32; Beta-glucosidase 46 OS=Arabidopsis thaliana E-value=2e-31; Beta-glucosidase 47 OS=Arabidopsis thaliana E-value=2e-28; Probable inactive beta-glucosidase 14 OS=Oryza sativa subsp. japonica E-value=4e-28; Beta-glucosidase 16 OS=Oryza sativa subsp. japonica E-value=1e-26; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_MGHG (2 ESTs); MTGIM (1 ESTs); MT_SROOT_KV0 (1 ESTs); |
Sequence | GTAAAAGATTGCATCTTCTCTGCATGTGAACAAAGAAAAAGGTCTTTAAAGACAGATGGT |
EST members of Unigene | AJ500367 BE203513 BE942787 BE942518 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.27178.1.S1_s_at, Mtr.43233.1.S1_at
|
Corresponding NCBI Gene | 842479 |
Trichome-related Gene from Literature | N/A |