| Detail of EST/Unigene TCMT59456 |
| Acc. | TCMT59456 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Glycine max E-value=1e-85; Glutathione S-transferase U8 OS=Arabidopsis thaliana E-value=1e-60; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-59; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=2e-58; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-58; |
| Length | 992 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JCVI-MT2 (4 ESTs); MT_JCVI-MT1 (2 ESTs); MT_GESD (2 ESTs); MT_CDS (1 ESTs); MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_INSECT (1 ESTs); |
| Sequence | GGACAACTTCTAAACTAAAATTCACATCGACATTTTGTGAAGAGCTTAGAATATCTAAAC |
| EST members of Unigene | BT053346 EV260755 EV256278 DW017127 CA990827 BI309950 BI271820 BI265681 GE350079 GE349167 GE345089 GE344049 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Msa.1760.1.S1_at, Mtr.44672.1.S1_at
|
| Corresponding NCBI Gene | 820083 |
| Trichome-related Gene from Literature | N/A |