Detail of EST/Unigene TCMT59929 |
Acc. | TCMT59929 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor C subunit 3 OS=Mus musculus E-value=3e-75; Replication factor C subunit 3 OS=Homo sapiens E-value=7e-75; Replication factor C subunit 3 OS=Bos taurus E-value=1e-74; Probable replication factor C subunit 3 OS=Dictyostelium discoideum E-value=1e-72; Replication factor C subunit 5 OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=2e-63; |
Length | 1459 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY (1 ESTs); MT_DFLOWER (1 ESTs); MT_PhoLEAF (1 ESTs); MT_Drought (1 ESTs); MT_CDS (1 ESTs); MT_DROOT (1 ESTs); MT_JCVI-MT1 (1 ESTs); |
Sequence | GTAACCAAAAAAAAAGAAGTGAGAACCCTAGACCGTCGCATCTGCAGCCTTCCACCCCGG |
EST members of Unigene | BT051590 BE319493 EV254971 DW016480 BI271926 BG458085 BF635262 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10756 replication factor C subunit 3/5; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10756 replication factor C subunit 3/5 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.33870.1.S1_at, Mtr.44673.1.S1_at
|
Corresponding NCBI Gene | 832836 |
Trichome-related Gene from Literature | N/A |