| Detail of EST/Unigene TCMT60620 |
| Acc. | TCMT60620 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-CoA acetyltransferase, cytosolic 1 OS=Arabidopsis thaliana E-value=3e-20; Probable acetyl-CoA acetyltransferase, cytosolic 2 OS=Arabidopsis thaliana E-value=1e-18; Acetyl-CoA acetyltransferase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=3e-11; Acetyl-CoA acetyltransferase IB OS=Candida tropicalis E-value=5e-09; Acetyl-CoA acetyltransferase IA OS=Candida tropicalis E-value=5e-09; |
| Length | 1362 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT (2 ESTs); MT_DLEAF (1 ESTs); MT_GPOD (1 ESTs); |
| Sequence | ATCAATATCACATGATACCACTCCCCCTTGAACTTTCTTTTGGGACCTCTTATGCCATTC |
| EST members of Unigene | BG453175 BI309067 BI267413 BI266009 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00362 Benzoate degradation via hydroxylation > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K07513 acetyl-CoA acyltransferase 1; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K07513 acetyl-CoA acyltransferase 1; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K07513 acetyl-CoA acyltransferase 1 |
| EC | 2.3.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
Mtr.13334.1.S1_at
|
| Corresponding NCBI Gene | 834876 |
| Trichome-related Gene from Literature | N/A |