Detail of EST/Unigene TCMT60680 |
Acc. | TCMT60680 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=1e-12; |
Length | 1268 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_LEAF_PHOMA (1 ESTs); MTUS_MIXTISSUE (1 ESTs); MT_FLOSEED_MTY (1 ESTs); |
Sequence | CGGATAGTCACAAAAATTAGGGAAGAAAAATGGCGGGAAACCAATTATTTAGATATTAAA |
EST members of Unigene | CA921124 DW015279 BQ139915 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10739 replication factor A2 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.34170.1.S1_at, Mtr.34170.1.S1_s_at, Mtr.4061.1.S1_at
|
Corresponding NCBI Gene | 821187 |
Trichome-related Gene from Literature | N/A |