Detail of EST/Unigene TCMT60700 |
Acc. | TCMT60700 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 78A4 OS=Pinus radiata E-value=1e-35; Cytochrome P450 78A3 OS=Glycine max E-value=7e-35; Cytochrome P450 78A11 OS=Oryza sativa subsp. japonica E-value=2e-31; Cytochrome P450 78A1 OS=Zea mays E-value=2e-29; Cytochrome P450 71A6 (Fragment) OS=Nepeta racemosa E-value=1e-13; |
Length | 838 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_Drought (1 ESTs); MT_HOGA (1 ESTs); MtBA (1 ESTs); |
Sequence | TAACATTCCTTTGGCTCCTAATCACAACACTTGTCTATCATGTTCTGAGATCAATATTTC |
EST members of Unigene | BG647403 AL370203 BF635802 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.9517.1.S1_at
|
Corresponding NCBI Gene | 843751 |
Trichome-related Gene from Literature | N/A |