Detail of EST/Unigene TCMT61239 |
Acc. | TCMT61239 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | UDP-glycosyltransferase 85A3 OS=Arabidopsis thaliana E-value=9e-43; UDP-glycosyltransferase 85A7 OS=Arabidopsis thaliana E-value=1e-42; UDP-glycosyltransferase 85A1 OS=Arabidopsis thaliana E-value=3e-42; UDP-glycosyltransferase 85A5 OS=Arabidopsis thaliana E-value=3e-42; UDP-glycosyltransferase 85A4 OS=Arabidopsis thaliana E-value=3e-39; |
Length | 605 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE (1 ESTs); MtBA (1 ESTs); |
Sequence | GTCATTGGCGGCTCCTTTATTATGTCATCTGAGTTTGAGAAAGAAATTTCAGATAGAGGT |
EST members of Unigene | CA921351 AL370080 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00699 glucuronosyltransferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00699 glucuronosyltransferase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00699 glucuronosyltransferase; Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K00699 glucuronosyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K00699 glucuronosyltransferase; |
EC | 2.4.1.17 2.4.1.47 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.24997.1.S1_s_at
|
Corresponding NCBI Gene | 838845 |
Trichome-related Gene from Literature | N/A |