Detail of EST/Unigene TCMT61672 |
Acc. | TCMT61672 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 18, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 17, peroxisomal OS=Arabidopsis thaliana E-value=1e-72; Acetyl-coenzyme A synthetase OS=Streptomyces coelicolor (strain ATCC BAA-471 / A3(2) / M145) E-value=3e-12; Acetyl-coenzyme A synthetase OS=Deinococcus radiodurans (strain ATCC 13939 / DSM 20539 / JCM 16871 / LMG 4051 / NBRC 15346 / NCIMB 9279 / R1 / VKM B-1422) E-value=6e-12; Acetyl-coenzyme A synthetase OS=Cronobacter sakazakii (strain ATCC BAA-894) E-value=2e-11; |
Length | 802 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_SROOT_KV1 (1 ESTs); MT_INSECT (1 ESTs); |
Sequence | TCGAGTCATTGAGGCAGCTGCAAGTAAAGTTATCGTGCTCCCTGTGATAGGTGATGATGT |
EST members of Unigene | BF004123 BI267726 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01908 propionyl-CoA synthetase |
EC | 6.2.1.1 6.2.1.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
Mtr.42683.1.S1_at
|
Corresponding NCBI Gene | 841977 |
Trichome-related Gene from Literature | N/A |