| Detail of EST/Unigene TCNB50753 |
| Acc. | TCNB50753 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 1040 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (22 ESTs); |
| Sequence | TTTTTGAAAAAATTCACATGTTCGCCATTAATTAATTCAAACCAATTTACACCACATTAA |
| EST members of Unigene | CN744224 CN748732 CN748339 CN746766 CN655252 CN745209 CN742060 CN744627 CN743843 CN745213 CN741870 CN741685 CN745000 CN745785 CN744009 CN743170 CN744938 CN743763 CN745141 CN745145 CN745542 CN747102 CN741619 CN747900 CN744591 CN741831 CN743550 CN745309 CN655329 CN743521 CN655555 CN741943 CN744705 CN748428 CN742152 CN746477 CN746285 CN747450 CN744526 CN747035 CN742927 CN742128 CN741881 CN743465 CN747968 CN746602 CN655517 CN743100 CN747605 CN748410 CN744299 CN741930 CN745866 CN747420 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |