| Detail of EST/Unigene TCNB50754 |
| Acc. | TCNB50754 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 7, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 678 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (1 ESTs); |
| Sequence | CAGCAAAAGCTTCTGGGTCTTCAGCAAGGCCTAACGGGTCGAAACTGCCACCAGGGTAAA |
| EST members of Unigene | CN745785 CN748732 CN748339 CN746766 CN744627 CN742060 CN746163 CN744009 CN747900 CN741619 CN747102 CN745542 CN745145 CN745141 CN743763 CN741870 CN741685 CN741881 CN745309 CN747450 CN746477 CN742152 CN748428 CN743521 CN655329 CN742927 CN747420 CN743465 CN746602 CN743100 CN747605 CN744299 CN745866 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |