| Detail of EST/Unigene TCNB51530 |
| Acc. | TCNB51530 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
| Length | 1032 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (61 ESTs); NB_GTISSUE (1 ESTs); |
| Sequence | TTTTATAGTAACCTCTTAACTTGTATACTTAATTCATGGAAAGCACATAAAATGTTACTG |
| EST members of Unigene | CN744201 CN746926 CN743602 CN742018 CN748301 CN655203 CN747125 CN748523 CN743820 CN745976 CN744997 CN741654 CN748922 CN742845 CN748688 CN744961 CN743742 CN741773 CN746102 CN748458 CN742167 CN742171 CN744546 EH365188 CN741398 CN745336 CN748866 CN741607 CN742998 CN743195 CN743836 CN748634 CN741532 CN748010 CN746450 CN743317 CN655131 CN743128 CN743524 CN744122 CN746465 CN743726 CN655560 CN745887 CN745102 CN748197 CN747988 CN742703 CN744039 CN742059 CN742857 CN745408 CN744434 CN748940 CN746004 CN747167 CN743682 CN745837 CN742692 CN748381 CN743854 CN748558 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |