| Detail of EST/Unigene TCNB51708 |
| Acc. | TCNB51708 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 936 nt |
| Species | Nicotiana benthamiana |
| Belonged EST Libraries | NB_SAL_US (49 ESTs); |
| Sequence | GGAAGATTAAAAGAATTCATTCTGTTGTCAAGTAACTCACAACAACTTTACAAGACCATC |
| EST members of Unigene | CN748503 CN746341 CN742613 CN742415 CN743805 CN746156 CN747716 CN745378 CN745969 CN745186 CN746142 CN746528 CN742996 CN743152 CN742962 CN743158 CN743362 CN745914 CN655373 CN742979 CN745335 CN744176 CN746325 CN747140 CN748337 CN741468 CN655508 CN747794 CN748196 CN743495 CN744095 CN744293 CN745274 CN746662 CN743736 CN744136 CN746229 CN655501 CN743084 CN748933 CN742458 CN744053 CN747565 CN742675 CN743073 CN742677 CN746599 CN746213 CN744455 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |