| Detail of EST/Unigene TCNT51691 |
| Acc. | TCNT51691 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; |
| Length | 1045 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (16 ESTs); NT_NNT (11 ESTs); NT_AGN_ELP (3 ESTs); NT_AGN_PNL (2 ESTs); NT_KL4B (1 ESTs); |
| Sequence | GACAGCTAACATCTCTATTACTTCAGCCATAATAAAAAACACTTACTTCTCCTTGCTAAA |
| EST members of Unigene | CV016551 EB430541 FG135576 FS375735 CV020986 EB435687 FG630774 FS410739 FG194965 CV020037 CV020814 CV015985 CV016759 EB435912 FG140023 EB434551 FG181026 EB435086 CV021743 DW001070 FS402025 DV161915 EB433487 CV018805 DW000886 FS400586 EB433500 CV018624 EB436990 FS437653 FS415164 FS411958 FG199738 FG195057 FG203174 CV018217 FS422521 FG192638 CV018380 FG193196 FS401990 CV016062 DV159556 FS410325 FS376178 CV019358 FS394615 FG193907 EB434245 DV162093 CV017434 FS375856 CV018212 EB433670 EB429056 CV018567 EB448687 FS421344 FS390555 DV999051 FG193107 EB682637 EB437469 CV019690 CV016793 CV019889 FG138122 EB437314 CV021261 FG626480 FS430240 FG187383 CV020281 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |