| Detail of EST/Unigene TCNT59063 |
| Acc. | TCNT59063 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=0; Cysteine synthase OS=Citrullus lanatus E-value=0; Cysteine synthase OS=Spinacia oleracea E-value=0; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=0; Cysteine synthase OS=Zea mays E-value=0; |
| Length | 1306 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | LIBEST_024954 (3 ESTs); LIBEST_026762 (2 ESTs); NT_KL5B (2 ESTs); NT_KT7 (2 ESTs); LIBEST_023330 (2 ESTs); NT_AGN_RNC (2 ESTs); NT_AGN_RPC (1 ESTs); NT_KG9B (1 ESTs); NT_MAT005 (1 ESTs); NT_SL (1 ESTs); NT_MAT001 (1 ESTs); NT_K326_LSL (1 ESTs); NT_TL13 (1 ESTs); NT_KN6B (1 ESTs); NT_KR2B (1 ESTs); LIBEST_026715 (1 ESTs); NT_KF8 (1 ESTs); |
| Sequence | ACAAAGTCACCGTACATTTGCATTCTAGTACCATCTTCAACCAGGGTCCTTTCTTGTCAT |
| EST members of Unigene | EB447182 FS403904 FG164435 EB448672 FG626585 HO844963 EB431288 EB439897 HS085234 FS424519 FG629539 EB679087 FG164511 HS085015 AM810032 BP128441 EB430258 EB424635 FS377635 BP534610 EB432817 FG148352 FG645165 EB449263 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |