| Detail of EST/Unigene TCNT60980 |
| Acc. | TCNT60980 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=0; |
| Length | 944 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NB_BL12 (10 ESTs); LIBEST_023330 (8 ESTs); NT_TL13 (8 ESTs); NT_NNT (7 ESTs); LIBEST_024954 (6 ESTs); NT_EST_FLW (6 ESTs); NT_KL4B (5 ESTs); NT_KL5B (3 ESTs); NT_AGN_ELP (3 ESTs); NT_AGN_PNL (2 ESTs); NT_KP1BS (1 ESTs); NT_KF8 (1 ESTs); NT_AGN_RNC (1 ESTs); NT_KT7 (1 ESTs); MT_CDS (1 ESTs); NT_KN6B (1 ESTs); |
| Sequence | GAGCTCATCACAGCCAACTTGGGCATTTCAAACCATCAAACACTCACTTTTCTTTTCAAA |
| EST members of Unigene | DV998802 EB438388 FS383591 EB437399 DV998985 EH615957 EB447674 EH615589 EH615590 FG184073 CV016931 EH615987 DV999013 EB435894 EB436060 EB436807 EB437778 FS428658 CV021702 FG627788 CV019001 EB427765 DV998959 CV019978 FG138723 EB433313 EB434093 FG626391 CV016895 EB435851 FG137104 FG621750 FG134584 EH615463 EB429032 DV998883 X52743 EB434405 EB437114 FS409925 EB430822 FG152353 FS407451 FG627639 CV021674 CV020524 FG629750 FG621937 FG621715 EB433952 EB436267 FG631298 FS380002 EB437064 EB435918 DV162592 FG183986 FS409215 EB429217 EB436693 EH615447 EB436683 EB436292 EB434171 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |