Detail of EST/Unigene TCSA16210 |
Acc. | TCSA16210 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=1e-23; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-20; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-19; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=1e-19; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=2e-19; |
Length | 275 nt |
Species | Solanum arcanum |
Belonged EST Libraries | SRR027943 (6 ESTs); |
Sequence | GACAATAGCTACATCTCTAACAACATAACTCATGGATGTCCACGGATTTTTGACCCAACA |
EST members of Unigene | SRR027943.459498 SRR027943.244403 SRR027943.48423 SRR027943.240022 SRR027943.34229 SRR027943.280389 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |