| Detail of EST/Unigene TCSF10204 |
| Acc. | TCSF10204 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=0; |
| Length | 999 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | |
| Sequence | AAACTCAAGCTTCAAAACAACTTTTCTTTTTGTACATTCAAGAGTTTCTCATTCTACTTC |
| EST members of Unigene | SRR027942.233211 SRR027942.258074 SRR027942.184004 SRR027942.84589 SRR027942.59729 SRR027942.138633 SRR027942.232834 SRR027942.286580 SRR027942.205216 SRR027942.66595 SRR027942.76188 SRR027942.210713 SRR027942.105473 SRR027942.81837 SRR027942.132383 SRR027942.142511 SRR027942.217717 SRR027942.286155 SRR027942.215568 SRR027942.136272 SRR027942.209302 SRR027942.48923 SRR027942.147595 SRR027942.167613 SRR027942.199907 SRR027942.173556 SRR027942.208507 SRR027942.221295 SRR027942.139036 SRR027942.28966 SRR027942.120942 SRR027942.25237 SRR027942.225840 SRR027942.286037 SRR027942.53702 SRR027942.143957 SRR027942.92455 SRR027942.288581 SRR027942.132450 SRR027942.97534 SRR027942.120157 SRR027942.212694 SRR027942.13805 SRR027942.271957 SRR027942.270395 SRR027942.166271 SRR027942.267087 SRR027942.149406 SRR027942.265719 SRR027942.52309 SRR027942.53682 SRR027942.293654 SRR027942.229930 SRR027942.256732 SRR027942.178362 SRR027942.215756 SRR027942.284688 SRR027942.109870 SRR027942.1626 SRR027942.117477 SRR027942.129371 SRR027942.197662 SRR027942.25487 SRR027942.263265 SRR027942.30989 SRR027942.33147 SRR027942.217068 SRR027942.55728 SRR027942.187229 SRR027942.246236 SRR027942.93856 SRR027942.37427 SRR027942.101061 SRR027942.51761 SRR027942.67645 SRR027942.291350 SRR027942.114724 SRR027942.74500 SRR027942.57850 SRR027942.172459 SRR027942.135401 SRR027942.239187 SRR027942.260352 SRR027942.283191 SRR027942.107402 SRR027942.282428 SRR027942.218876 SRR027942.5235 SRR027942.166007 SRR027942.179236 SRR027942.281273 SRR027942.145824 SRR027942.151939 SRR027942.193415 SRR027942.130998 SRR027942.18253 SRR027942.44967 SRR027942.230821 SRR027942.135657 SRR027942.62013 SRR027942.297088 SRR027942.106978 SRR027942.220031 SRR027942.24145 SRR027942.130967 SRR027942.61232 SRR027942.89028 SRR027942.115367 SRR027942.224560 SRR027942.27295 SRR027942.250586 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |