| Detail of EST/Unigene TCSF10849 |
| Acc. | TCSF10849 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=0; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=0; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=0; |
| Length | 1013 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (76 ESTs); |
| Sequence | GATCACAACTAACTTTTACATATCAAACTAGCAACTCCCTCATCTTCCTCTCTTTAAAAA |
| EST members of Unigene | SRR027942.67958 SRR027942.235956 SRR027942.83220 SRR027942.103729 SRR027942.72668 SRR027942.104125 SRR027942.107443 SRR027942.169224 SRR027942.280908 SRR027942.207931 SRR027942.213218 SRR027942.98821 SRR027942.158722 SRR027942.89854 SRR027942.30277 SRR027942.207733 SRR027942.290673 SRR027942.149366 SRR027942.27953 SRR027942.104518 SRR027942.68411 SRR027942.39781 SRR027942.225653 SRR027942.111395 SRR027942.85620 SRR027942.100647 SRR027942.95179 SRR027942.80723 SRR027942.79350 SRR027942.78373 SRR027942.80716 SRR027942.135940 SRR027942.270601 SRR027942.139046 SRR027942.85201 SRR027942.249101 SRR027942.122670 SRR027942.200765 SRR027942.212524 SRR027942.222756 SRR027942.53957 SRR027942.17998 SRR027942.101875 SRR027942.175048 SRR027942.155461 SRR027942.35882 SRR027942.54914 SRR027942.117273 SRR027942.119994 SRR027942.181922 SRR027942.9704 SRR027942.286450 SRR027942.201950 SRR027942.121165 SRR027942.203115 SRR027942.270050 SRR027942.659 SRR027942.7583 SRR027942.182577 SRR027942.40654 SRR027942.73788 SRR027942.165813 SRR027942.187491 SRR027942.98609 SRR027942.80443 SRR027942.167203 SRR027942.238073 SRR027942.113617 SRR027942.123365 SRR027942.68872 SRR027942.139339 SRR027942.172110 SRR027942.87066 SRR027942.10743 SRR027942.233549 SRR027942.178442 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |