| Detail of EST/Unigene TCSF12332 |
| Acc. | TCSF12332 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Ent-copalyl diphosphate synthase, chloroplastic OS=Pisum sativum E-value=4e-28; Ent-copalyl diphosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-26; Levopimaradiene synthase, chloroplastic OS=Ginkgo biloba E-value=4e-25; Levopimaradiene synthase, chloroplastic OS=Pinus taeda E-value=7e-25; Isopimaradiene synthase, chloroplastic OS=Picea abies E-value=3e-24; |
| Length | 383 nt |
| Species | Solanum pimpinellifolium |
| Belonged EST Libraries | SRR027942 (8 ESTs); |
| Sequence | TCAGATGAGGAATTTGAGAGAAGAGATAAAAAATATGTTGAGTTCCATGGGAGATGGAAG |
| EST members of Unigene | SRR027942.238383 SRR027942.215834 SRR027942.274680 SRR027942.126557 SRR027942.88842 SRR027942.43383 SRR027942.288433 SRR027942.75101 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828182 |
| Trichome-related Gene from Literature | 828182 |