| Detail of EST/Unigene TCSH50041 |
| Acc. | TCSH50041 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 2 OS=Glycine max E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Arabidopsis thaliana E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum OS=Brassica juncea E-value=0; Omega-6 fatty acid desaturase, endoplasmic reticulum isozyme 1 OS=Glycine max E-value=0; Delta(12) fatty acid dehydrogenase OS=Crepis alpina E-value=0; |
| Length | 1575 nt |
| Species | Solanum habrochaites |
| Belonged EST Libraries | SRR027941 (110 ESTs); SRR027940 (29 ESTs); LIBEST_025268 (2 ESTs); LIBEST_025265 (1 ESTs); LIBEST_025264 (1 ESTs); SH_TRI (1 ESTs); |
| Sequence | AGACACAAACACAACCATTTATATTAAAACTGGTAGTTTATTACATACTAAAAGGAGGTG |
| EST members of Unigene | SRR027941.264144 SRR027940.78366 SRR027940.42232 SRR027941.19050 SRR027941.66533 SRR027940.124902 SRR027941.273879 SRR027941.316942 SRR027941.145398 SRR027941.82929 SRR027941.268187 SRR027941.287100 SRR027941.36132 SRR027941.90033 SRR027941.229241 SRR027940.19846 SRR027941.10231 SRR027941.249403 SRR027941.143764 SRR027941.281550 SRR027941.275481 SRR027941.200179 AW616440 SRR027941.292158 SRR027941.6755 SRR027941.115805 SRR027941.12799 SRR027941.245555 SRR027941.103585 SRR027940.11316 SRR027941.280955 SRR027941.258083 SRR027941.93042 SRR027941.216714 SRR027940.16922 SRR027940.124296 SRR027941.103625 SRR027941.301757 GT183643 SRR027941.216564 SRR027941.129440 SRR027941.50424 SRR027941.154773 SRR027941.108320 SRR027941.180321 SRR027940.34944 SRR027941.174487 SRR027941.309458 SRR027941.118101 SRR027940.108358 SRR027941.82774 SRR027941.66798 SRR027941.161092 SRR027941.229670 SRR027941.316569 SRR027941.223398 SRR027941.133055 SRR027941.320227 SRR027941.200229 SRR027941.132854 SRR027941.130847 SRR027941.91255 SRR027940.113157 SRR027940.130530 SRR027941.26318 SRR027941.41566 SRR027941.280598 SRR027941.201251 SRR027941.31127 SRR027941.320853 SRR027941.181311 SRR027941.94742 SRR027941.137555 SRR027941.95183 SRR027941.50071 SRR027941.292075 SRR027941.109199 SRR027941.276626 SRR027941.278447 SRR027940.64168 SRR027941.251932 SRR027941.215011 SRR027940.19740 SRR027941.53097 SRR027941.284541 SRR027941.25592 SRR027941.241639 SRR027941.13334 SRR027941.191238 SRR027941.27786 SRR027941.180966 SRR027940.93886 SRR027941.66207 SRR027941.205938 SRR027941.277411 SRR027940.95635 SRR027941.83602 SRR027941.186183 SRR027941.305430 SRR027941.233339 SRR027941.137772 GT183597 SRR027941.234356 SRR027941.262614 SRR027940.107810 SRR027940.92941 SRR027941.11122 SRR027941.8304 SRR027941.60241 SRR027941.287847 SRR027941.39669 SRR027940.25962 SRR027941.92591 SRR027941.82670 SRR027940.41605 SRR027941.54145 SRR027941.41482 SRR027941.80065 SRR027941.155895 SRR027941.98884 SRR027940.107296 SRR027941.64876 SRR027941.100105 SRR027941.157949 SRR027940.22311 GT163015 SRR027941.225542 SRR027940.26122 SRR027940.120576 SRR027941.102916 SRR027940.95478 SRR027941.82637 SRR027941.327890 SRR027941.319108 GT161430 SRR027940.43898 SRR027940.77520 SRR027940.92021 SRR027941.91565 SRR027940.26721 SRR027940.17445 SRR027941.53922 SRR027941.25611 SRR027941.259633 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.14.19.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820387 |
| Trichome-related Gene from Literature | 820387 |