Detail of EST/Unigene TCSH51792 |
Acc. | TCSH51792 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Farnesyl pyrophosphate synthase 1 OS=Lupinus albus E-value=0; Farnesyl diphosphate synthase 1 OS=Artemisia spiciformis E-value=0; Farnesyl pyrophosphate synthase 2 OS=Parthenium argentatum E-value=0; Farnesyl pyrophosphate synthase 2 OS=Lupinus albus E-value=0; Farnesyl pyrophosphate synthase OS=Artemisia annua E-value=0; |
Length | 1385 nt |
Species | Solanum habrochaites |
Belonged EST Libraries | SRR027941 (45 ESTs); SRR027940 (8 ESTs); LIBEST_025268 (6 ESTs); LH__Ea (2 ESTs); |
Sequence | GAACCTCAGATCTCTTCCTTCTCTGTTTATACACATATACATTAACTTTTTTTTTCTCTG |
EST members of Unigene | SRR027941.124942 SRR027941.125562 SRR027941.149271 SRR027940.92857 SRR027941.315925 SRR027941.145996 SRR027941.326320 SRR027941.304333 SRR027941.284823 SRR027941.83913 GT172746 SRR027941.124102 SRR027941.314058 SRR027941.256291 SRR027941.283425 SRR027941.46186 SRR027941.62163 SRR027940.123228 SRR027941.315368 SRR027941.69608 SRR027940.132285 SRR027941.303585 SRR027941.137529 SRR027941.109136 SRR027940.88828 SRR027941.69586 SRR027940.28546 SRR027941.88828 SRR027941.14243 SRR027940.12656 SRR027941.42911 SRR027941.122375 SRR027941.276415 SRR027941.36405 DN170898 SRR027941.150955 GT176553 DN170518 SRR027941.160300 GT177119 SRR027941.262402 SRR027941.41206 SRR027941.50049 SRR027941.309677 SRR027941.54471 SRR027941.284124 SRR027941.166846 SRR027941.2522 SRR027941.293765 SRR027940.73878 SRR027941.121850 SRR027941.102739 GT182054 SRR027941.83263 SRR027941.34054 GT176601 SRR027941.92155 SRR027941.313397 SRR027941.207204 SRR027940.58780 GT174431 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00787 dimethylallyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00787 dimethylallyltranstransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00900 Terpenoid biosynthesis > K00795 geranyltranstransferase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K00795 geranyltranstransferase |
EC | 2.5.1.1 2.5.1.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827430 |
Trichome-related Gene from Literature | 827430 |