| Detail of EST/Unigene TCSL70009 |
| Acc. | TCSL70009 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | unknown |
| Length | 1310 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (5 ESTs); LIBEST_024426 (5 ESTs); SL_maturing_fruit (3 ESTs); SRR015436 (3 ESTs); SL_ROOTPHOS (2 ESTs); SL_MicroFRUIT (2 ESTs); SL_CDS (2 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_DROOT (1 ESTs); SL_CROWNGALL (1 ESTs); SL_Lyc_leaf (1 ESTs); SL_cTOS (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_GFRUIT (1 ESTs); |
| Sequence | TTGTTCTTTCTTTTATAGCATCAGTTTTTTGACTTCTTTCAATACAACAAGATAAGCGGA |
| EST members of Unigene | SRR015435.114599 SRR015435.138217 BP882587 BP900943 AW648551 BT013938 BP878515 BG132997 EG553662 BP878676 SRR015435.243574 SRR015435.77066 BI207700 DB716744 FS195269 DB720929 SRR015436.86833 AB193043 SRR015436.136700 SRR015435.298271 BE458681 AW030928 FS201598 AW648410 DV105246 DV105274 FS203114 FS199195 SRR015436.273900 FS194548 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828267 |
| Trichome-related Gene from Literature | 828267 |