| Detail of EST/Unigene TCSL73757 |
| Acc. | TCSL73757 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable rhamnose biosynthetic enzyme 1 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 3 OS=Arabidopsis thaliana E-value=0; Probable rhamnose biosynthetic enzyme 2 OS=Arabidopsis thaliana E-value=0; dTDP-D-glucose 4,6-dehydratase OS=Mus musculus E-value=4e-88; dTDP-D-glucose 4,6-dehydratase OS=Dictyostelium discoideum E-value=6e-87; |
| Length | 2395 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (11 ESTs); SL_MicroLEAF3 (7 ESTs); SL_TAMU (4 ESTs); LIBEST_024426 (4 ESTs); SL_MicroFRUIT (4 ESTs); SRR015436 (3 ESTs); SL_PRERIP_FRUIT_TAMU (2 ESTs); SL_GFRUIT (2 ESTs); SL_maturing_fruit (2 ESTs); LIBEST_024457 (2 ESTs); SL_RIP_FRUIT_TAMU (2 ESTs); SL_cTOS (2 ESTs); SL_CALLUS (1 ESTs); SL_TRI (1 ESTs); SL_FLOWERBUDS (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_RES (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_flower_buds4 (1 ESTs); SL_FLOWERBUDS3 (1 ESTs); |
| Sequence | TCTCTATAAAGGCCGAAGCACTCGGCGATTTTGTACTCTTTTTTTCTTCTTCTTCTCTCT |
| EST members of Unigene | DB693968 SRR015436.115721 AI486284 BE353784 SRR015436.164752 FS200975 AI897900 FS202242 DB712598 FS197286 BP885492 SRR015435.22646 DB685603 ES894321 SRR015435.125908 SRR015435.166197 SRR015436.186562 SRR015435.253456 AW933793 BG628470 BF050846 DB695099 AW929920 BI922031 AW931088 GO374460 DB709927 BP883269 AI775671 DB698900 BI210155 SRR015435.29194 BI927549 DB723418 BF051373 DB690384 AW222092 GO374319 FS203202 SRR015435.282013 SRR015435.115889 AW222210 DB689481 BW686975 SRR015435.17191 AI486136 SRR015435.129282 AI490035 DB727062 DB687432 BI210137 SRR015435.147663 SRR015435.82763 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Carbohydrate Metabolism > ko00520 Nucleotide sugars metabolism > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01055 Biosynthesis of vancomycin group antibiotics > K01710 dTDP-glucose 4,6-dehydratase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko00523 Polyketide sugar unit biosynthesis > K01710 dTDP-glucose 4,6-dehydratase |
| EC | 4.2.1.46 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844193 |
| Trichome-related Gene from Literature | 844193 |