| Detail of EST/Unigene TCSL73758 |
| Acc. | TCSL73758 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; ATP-dependent zinc metalloprotease FTSH 2, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 8, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Arabidopsis thaliana E-value=0; ATP-dependent zinc metalloprotease FTSH 6, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 2380 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015436 (43 ESTs); SL_Lyc_leaf (31 ESTs); SRR015435 (26 ESTs); SL_CELL_BTI (4 ESTs); SL_MicroLEAF3 (3 ESTs); SL_maturing_fruit (2 ESTs); SL_FLOWERBUDS (2 ESTs); SL_flower_anthesis (2 ESTs); SL_flowerbuds4 (1 ESTs); SL_ROOT (1 ESTs); SL_TAMU_CALLUS (1 ESTs); SL_SHOOT_4WEEK (1 ESTs); SL_PRERIP_FRUIT_TAMU (1 ESTs); SL_TRI (1 ESTs); LIBEST_024426 (1 ESTs); SL_RES (1 ESTs); LIBEST_024458 (1 ESTs); SL_FLOWER_DEV (1 ESTs); SL_DEF_ROOT (1 ESTs); SL_FRUIT (1 ESTs); SL_breaker_fruit (1 ESTs); |
| Sequence | CATCTTCTTCCTTTCTGTTACGGAGTTATCTTTCCTCTGTCAACTTTATCAGGTTCTTGC |
| EST members of Unigene | AW040697 SRR015436.96091 SRR015436.140110 SRR015436.227141 SRR015435.238512 SRR015435.197718 BP896835 SRR015435.95650 BG130407 BP906878 BP908808 BP909772 SRR015436.229157 AW217355 BI933759 SRR015436.127506 SRR015436.45779 SRR015435.228001 AW737540 SRR015435.74682 SRR015436.206521 SRR015435.46764 SRR015436.267295 SRR015436.63654 SRR015436.123732 SRR015435.309617 SRR015436.97792 BP907481 SRR015436.277856 AW092922 SRR015436.250984 BP910734 BP910926 SRR015436.65064 AI773209 AW219238 SRR015435.40807 SRR015436.272541 BI933515 DB682448 AW092275 BP880380 BP906452 BP896985 SRR015435.289337 BP907997 SRR015435.214673 SRR015436.82853 SRR015436.118741 SRR015435.337569 BP910149 SRR015435.187824 BP900874 AW035651 SRR015436.289315 FS195106 SRR015436.90911 SRR015435.224184 BP909755 SRR015435.212136 SRR015436.90916 BP897001 SRR015436.168037 SRR015436.75903 BE461585 BP902367 SRR015435.88558 SRR015436.73959 AW737612 BM535761 BP909115 SRR015435.22008 GO376085 BP910080 BP907374 AW934098 SRR015436.298063 SRR015436.152688 SRR015436.294874 BP908943 BP908182 SRR015436.52952 BG628806 SRR015436.253955 BP906822 SRR015436.135467 SRR015435.80402 BP908173 SRR015436.72608 SRR015436.124047 SRR015436.159560 SRR015436.298456 SRR015436.25669 SRR015435.32124 BF098202 BP894372 SRR015436.134305 BP904826 SRR015436.159429 SRR015436.150094 SRR015436.264240 SRR015436.252271 BP898440 AW092766 SRR015435.355543 DB707209 SRR015435.97537 SRR015436.79726 SRR015436.127887 ES893661 SRR015435.121914 SRR015435.244258 SRR015436.283498 SRR015435.245989 SRR015436.249201 SRR015435.250059 DB691349 BP906389 BP908321 BP910059 BP908312 BP905803 BP904452 BP910636 SRR015435.56028 SRR015435.278941 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.4.24.- 3.6.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817646 |
| Trichome-related Gene from Literature | 817646 |