| Detail of EST/Unigene TCSL73822 |
| Acc. | TCSL73822 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable cellulose synthase A catalytic subunit 8 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=0; Cellulose synthase A catalytic subunit 3 [UDP-forming] OS=Arabidopsis thaliana E-value=0; Probable cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=0; Probable cellulose synthase A catalytic subunit 2 [UDP-forming] OS=Oryza sativa subsp. indica E-value=0; Probable cellulose synthase A catalytic subunit 1 [UDP-forming] OS=Oryza sativa subsp. japonica E-value=0; |
| Length | 2170 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (20 ESTs); SRR015436 (10 ESTs); SL_cTOS (6 ESTs); SL_maturing_fruit (6 ESTs); SL_TAMU_CALLUS (4 ESTs); SL_flower_anthesis (3 ESTs); SL_DEF_ROOT (2 ESTs); SL_Lyc_leaf (2 ESTs); SL_germ_seedlings_TAMU (2 ESTs); SL_TAMU (2 ESTs); SL_SHOOT_4WEEK (2 ESTs); SL_GFRUIT (2 ESTs); SL_RES (1 ESTs); LIBEST_024456 (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_flower_buds3 (1 ESTs); SL_MicroLEAF3 (1 ESTs); LIBEST_025267 (1 ESTs); |
| Sequence | GGGACAAAGTGGAGGACTTGATAGTGATGGAAATGAGTTGCCACGACTAGTGTATGTTTC |
| EST members of Unigene | SRR015435.30253 AI774618 SRR015436.228024 BI935306 SRR015435.135534 SRR015435.272827 AW033755 SRR015435.352071 BI422108 BF096668 DB707191 SRR015435.64805 BI204101 BI207770 AW033579 SRR015436.249078 SRR015436.324226 SRR015435.292199 BP886172 SRR015435.39247 BI926453 SRR015435.104012 GT168646 SRR015436.319391 BP889079 SRR015435.138867 AW648275 BP884256 BI203656 SRR015436.117465 BE458942 SRR015435.163851 SRR015435.51696 BP882973 SRR015435.322673 SRR015435.229682 BP906601 SRR015436.264623 SRR015436.113323 BI206492 AI484425 GO372924 BG126666 SRR015435.9560 AI484438 BI933878 BP880166 AW648245 BG128037 SRR015435.98835 AW034221 BP908916 AW222584 SRR015435.228575 SRR015435.168449 SRR015435.163787 BI935926 SRR015436.235284 BF050525 BI204124 SRR015436.197161 BI207636 SRR015435.303149 BP882439 BF096316 SRR015435.173279 SRR015436.55902 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830399 |
| Trichome-related Gene from Literature | 830399 |