Detail of EST/Unigene TCSL74215 |
Acc. | TCSL74215 |
Internal Acc. | |
Type | TC/Unigene |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-1 OS=Nicotiana tabacum E-value=0; Hexokinase-2 OS=Solanum tuberosum E-value=0; Hexokinase-1 OS=Solanum tuberosum E-value=0; Hexokinase-1 OS=Spinacia oleracea E-value=0; Hexokinase-1 OS=Arabidopsis thaliana E-value=0; |
Length | 1777 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SRR015436 (8 ESTs); SRR015435 (8 ESTs); SL_MicroLEAF3 (3 ESTs); SL_SUS_LEAF (1 ESTs); SL_CDS (1 ESTs); LIBEST_024426 (1 ESTs); SL_maturing_fruit (1 ESTs); SL_MicroFRUIT2 (1 ESTs); SL_CELL_BTI (1 ESTs); |
Sequence | CCTCTCTGTAATTTTTATTATTTCTCCTTAAAAAATCACAAATCTTTACTTTACTCATTT |
EST members of Unigene | BP882758 SRR015436.136818 SRR015436.250370 SRR015435.161892 AJ401153 SRR015436.192786 DB678653 SRR015435.232527 SRR015436.119376 SRR015435.350965 SRR015435.155343 SRR015435.308452 SRR015435.155854 AI777968 SRR015435.82717 SRR015436.130514 SRR015436.322688 SRR015435.232967 SRR015436.148231 DB680456 AW039409 DB701294 BW691334 FS192941 SRR015436.244841 |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829034 |
Trichome-related Gene from Literature | 829034 |