| Detail of EST/Unigene TCSL74314 |
| Acc. | TCSL74314 |
| Internal Acc. | |
| Type | TC/Unigene |
| Annotation (Top 5 hits in Uniprot_trembl) | Pre-mRNA-splicing factor SF2 OS=Arabidopsis thaliana E-value=3e-72; Probable splicing factor, arginine/serine-rich 3 OS=Caenorhabditis elegans E-value=6e-47; Serine/arginine-rich splicing factor 1B OS=Danio rerio E-value=7e-47; Serine/arginine-rich splicing factor 1 OS=Gallus gallus E-value=1e-46; Serine/arginine-rich splicing factor 1 OS=Pongo abelii E-value=3e-45; |
| Length | 1728 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SRR015435 (16 ESTs); SL_MicroLEAF3 (6 ESTs); SL_TAMU_CALLUS (4 ESTs); SRR015436 (4 ESTs); SL_SHOOT_4WEEK (3 ESTs); SL_Lyc_leaf (2 ESTs); SL_CELL_BTI (2 ESTs); SL_CROWNGALL (2 ESTs); SL_pericarp (2 ESTs); SL_flower_buds3 (2 ESTs); SL_FLOWER_DEV (2 ESTs); SL_flower_buds4 (1 ESTs); SL_RIP_FRUIT_TAMU (1 ESTs); SL_cTOS (1 ESTs); SL_maturing_fruit (1 ESTs); SL_FLOWERBUDS (1 ESTs); LIBEST_024426 (1 ESTs); LIBEST_024457 (1 ESTs); SL_DEF_ROOT (1 ESTs); |
| Sequence | AACTCTGTGAACTAGTCAATTCTATTTCTCAAAGTGGGATAAGAAAGGGTTATAACTCAC |
| EST members of Unigene | BI927620 SRR015435.109005 BI923792 AW031987 SRR015436.160701 SRR015435.281917 SRR015435.200436 BP884106 BG627919 SRR015435.103957 CD002384 SRR015435.260597 SRR015435.62312 DB700348 AW038499 BI924329 DB704339 CD002334 FS188611 BI205393 DB681850 SRR015436.257185 BP900301 SRR015435.253651 BP898184 SRR015435.7975 SRR015435.110914 BG128914 SRR015436.13592 BF098229 BG643371 BG131568 SRR015435.114878 AW029788 SRR015435.209433 AW030765 DB698751 SRR015435.326355 AW041618 DB685647 GO374686 SRR015435.69179 BG130268 DB708813 BE353814 SRR015435.317706 SRR015436.102447 SRR015435.297148 BG133269 BG628389 AW222643 AW034807 SRR015435.126343 |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839262 |
| Trichome-related Gene from Literature | 839262 |